구독하기
연구 모델
서비스
전임상 효능 평가
Resource
NKG Mouse
제품 견적 요청
카탈로그에서 제품을 선택하여 요청을 제출해 주세요. Cyagen 팀이 상세 정보를 제공해 드립니다.
NKG Mouse
제품명
NKG Mouse
제품 ID
C001316
품종 계통
NOD.Cg-PrkdcscidIl2rgem1cya/Cya
Backgroud
NOD.Cg
Coat Color
White
Breeding Strategy
Sibling x Sibling
상태
이 마우스 계통을 논문에서 사용할 경우, “NKG Mouse (카탈로그 번호 C001316)은 Cyagen에서 구입하였습니다.”라고 명시해 주시기 바랍니다.
Immunodeficient Mice
구매 가능한 제품 종류
연령
Genotype
성별
수량
표준 제공 조건은 최소 3마리의 이형접합(heterozygous) 보균자를 보장합니다. 동형접합(homozygous) 보균자 및/또는 특정 성별에 대한 브리딩 서비스도 제공됩니다.
가격 문의
Immunodeficient Mice
기본 정보
검증 데이터
관련 자료
기본 정보
유전자명
유전자 별칭
gc, p64, [g]c, CD132, gamma(c)
NCBI ID
염색체
Chr X
MGI ID
Datasheet
품종 계통 설명
NKG mice are a kind of severe immunodeficient mice generated by Cyagen by deleting the Il2rg gene from NOD-Scid genetic background mice. NKG mice exhibit deficiency of mature T cells, B cells, and functional NK cells, reduced complement activity, and weak phagocytosis of human-derived cells by macrophages, which are well suited for transplantation of human hematopoietic stem cells (HSC), peripheral blood mononuclear cells (PBMC), adult stem cells and tissues, and patient-derived xenograft (PDX).
NKG mice are currently recognized as one of the models with the highest degree of immunodeficiency. They are an excellent model that can be widely used for research in the fields of oncology, immunity, autoimmune diseases, immunotherapy, vaccines, graft-versus-host disease (GvHD), and drug safety evaluation.
응용 분야
Immune system and tumor immunity research;
Hematopoietic development and blood disorders research;
Infectious disease studies such as HIV and AIDS;
Tumor transplantation and anti-tumor efficacy studies;
CDX, PDX, GvHD, and humanized immune system (HIS) research.
검증 데이터
1. Detection of Prkdc gene mutation
MT: TAACGGAAAAGAATTGGTATCCACAACATAAAATACGCTAAGCTAAGAGAAAGTTAGCAGGGGCCAACCCAGCTGTTATA

Figure 1. Mutation type detection of Prkdc gene in NKG mice. The Prkdcsscid mutation was generated by TAT→TAA transition in exon 84 of the Prkdc gene, and gene sequencing results showed that NKG mice carried the Prkdcsscid mutation.
2. Detection of Il2rg knockout

Figure 2. Deletion of Il2rg gene in NKG mice. PCR assay of the Il2rg gene in NKG mice showed successful deletion of the Il2rg gene in NKG mice (Band size of wild-type Il12rg gene: 1430bp; band size of Il12rg gene with partial fragment knocked out: 388bp).
3. Detection of B, T, and NK cells in the Peripheral Blood (PB) of NKG mice

Figure 3. NKG mice showed severe immunodeficiency with severe deficiency of B, T, and NK cells in peripheral blood (PB). The results showed that B cells (CD3-CD19+), T cells (CD3+CD19-), T helper cells (CD3+CD4+CD8-), cytotoxic T cells (CD3+CD4-CD8+), and NK cells (CD335+CD3-) were almost completely absent in the peripheral blood of NKG mice.
4. Detection of B, T, and NK cells in the spleen of NKG mice


Figure 4. NKG mice showed severe immunodeficiency with severe deficiency of B, T, and NK cells in the spleen. The results showed that B cells (CD3-CD19+), T cells (CD3+CD19-), T helper cells (CD3+CD4+CD8-), cytotoxic T cells (CD3+CD4-CD8+), and NK cells (CD335+CD3-) were almost completely absent in the spleen of NKG mice.
5. --
(1)Survival curve

Figure 5. The survival curve of huPBMC-NKG mice. Around 35 days after transplantation, huPBMC-NKG mice gradually began to die as graft-versus-host disease (GvHD) appeared. After 60 days of transplantation, about 20% of the mice were still alive.
(2)Proportion of human leukocytes

Figure 6. The proportion of human CD45+ cells in peripheral blood (PB) of huPBMC-NKG mice. After transplantation of human PBMCs, the content of human leukocytes in the peripheral blood of NKG mice gradually increased. After 3 weeks, the average proportion of human CD45+ cells exceeded 40%, and the reconstruction speed was relatively fast (similar products generally take 4 weeks to reach the same level of humanization ratio). After transplantation, the humanization ratio remained high for 3-6 weeks.
(3)Proportion of T-cell reconstitution

Figure 7. The proportion of human CD3+ T cells in the peripheral blood of huPBMC-NKG mice. About 95%- 100% of hCD45+ cells in NKG mice belong to hCD3+ T cells 3 weeks after human PBMC transplantation, indicating that the reconstruction of the human immune system in huPBMC-NKG mice was dominated by T cells.
(4)The Graft-versus-Host Disease (GvHD)

Figure 8. GvHD scores and body weight changes in NKG mice after PBMC transplantation. GvHD symptoms begin to appear around 28d. Mice lost a significant amount of body weight, and the body weight was reduced by more than 20% after 45d.
6. NKG mice (Adult) for the study in huCD34+ HSC (huHSC) humanized immune system
(1)Survival curve

Figure 9. The survival curve of huHSC-NKG adult mice. The huHSC-NKG adult mice were free of graft-versus-host disease (GvHD) and maintained a high survival rate of over 70% after 150 days post-engraftment.
(2)Growth curve

Figure 10. The growth curve of huHSC-NKG adult mice. The huHSC-NKG adult mice maintained normal weight gain after the transplantation of huHSC.
(3)Proportion of human leukocytes

Figure 11. The proportion of human CD45+ cells in peripheral blood of huHSC-NKG adult mice. The percentage of human leukocytes gradually increased, and the average rate of human CD45+ cells reached more than 60%.
(4)Proportions of human T cells and B cells

Figure 12. Proportions of human T cells and B cells in huHSC-NKG adult mice. The reconstruction of the immune system in this model was dominated by B cells in the early stage. The proportion of B cells gradually decreased and the proportion of T cells gradually increased in the later stage. At 12 weeks post-engraftment, the proportion of T cells began to increase, reaching about 40% at week 16. The proportion of B cells was higher at the early stage, reaching 80%, and decreased to 15% at week 24.
(5)Proportions of human NK cells and monocytes

Figure 13. Proportions of human NK cells and monocytes in huHSC-NKG adult mice. The proportions of NK cells and monocytes during immune system reconstitution were low. The average proportion of NK cells maintained at about 2% overall and the proportion of monocytes at week 16 was about 2%.
7. NKG mice (Newborn) for the study in huHSC humanized immune system
(1)Survival curve

Figure 14. The survival curve of huHSC-NKG newborn mice. The huHSC-NKG newborn mice were free of graft-versus-host disease (GvHD). The survival rate of huHSC-NKG newborn mice maintained more than 90% before 100 days post engraftment and the survival rate still maintained more than 80% nearly 150 days post engraftment, which was higher than that of the adult model.
(2)Growth curve

Figure 15. The growth curve of huHSC-NKG newborn mice. The huHSC-NKG newborn mice maintained normal weight gain after the transplantation of huHSC.
(3)Proportion of human leukocytes

Figure 16. The proportion of human CD45+ cells in peripheral blood of huHSC-NKG newborn mice. The percentage of human leukocytes gradually increased. The average percentage of human CD45+ leukocytes reached more than 40% after 8 weeks post engraftment and subsequently increased and maintained at about 60%.
(4)Proportions of human T cells and B cells

Figure 17. Proportions of human T cells and B cells in huHSC-NKG newborn mice. Similar to the adult model, the reconstruction of the immune system in this model was dominated by B cells in the early stage. The proportion of B cells gradually decreased and the proportion of T cells gradually increased in the later stage. At 12 weeks post-engraftment, the proportion of T cells began to increase, reaching about 40% at week 14. The proportion of B cells was higher than 80% at the early stage and decreased continuously, dropping to 40% at week 20.
(5)Proportions of human NK cells and monocytes

Figure 18. Proportions of human NK cells and monocytes in huHSC-NKG newborn mice. The proportions of NK cells and monocytes were higher in this newborn model than in the adult model. The average percentage of NK cells was more than 10% in the early stage and maintained at about 5% in the later stage. The average percentage of monocytes was higher than 5%. Therefore, the newborn model is more suitable for studies related to myeloid cell targets.
8. NKG mice for the establishment of cell line-derived xenograft (CDX) models

Figure 19. Tumor growth curves after subcutaneous xenografts of various human-derived tumor cells. Tumor cells were inoculated into NKG and NOD-Scid mice by subcutaneous injection at a cell inoculation rate of 5x10^6/each, and tumorigenic volumes were measured at different time points. The results showed that human pancreatic cancer cell line PANC-1, human liver cancer cell line Huh7, human gastric cancer cell line HGC-27, and human colon adenocarcinoma cell line SW620 were effective in establishing tumor models on NKG mice. The rate of tumor growth, as well as size in NKG mice, were better than those in NOD-Scid mice
9. NKG mice for the establishment of a hematological tumor cell transplantation model

Figure 20. Tumor growth in NKG mice after transplantation of human Jurkat cells. Transplant human T-lymphocyte cell line Jurkat with luciferase marker into NKG mice by tail vein injection and subsequently detect tumor growth by fluorescence generation. The results showed that Jurkat lymphocyte cells could grow in NKG mice, indicating the successful establishment of this tumor model.
10. The anti-tumor pharmacodynamics of paclitaxel on the human lymphoma (Raji-Luc) CDX model

Figure 21. The anti-tumor pharmacodynamics of paclitaxel on the human lymphoma (Raji-Luc) CDX model. Transplant human lymphoma (Raji-Luc) cell lines into NKG mice and treat with the anti-cancer drug paclitaxel (PTX) to verify the effect of tumorigenesis in NKG mice and the pharmacodynamic. The results showed that the human lymphoma (Raji-Luc) cell line could grow normally in mice and lead to their death by day 28. In contrast, treatment with paclitaxel (PTX) effectively attenuated tumor development and maintained the survival of mice.
11. Establishment of PANC-1 pancreatic in-situ model using NKG mice



Figure 22. Establishment of a pancreatic in-situ model using NKG mice. After transplanting the human pancreatic cancer cell line PANC-1 into NKG mice, the fluorescent effect, mouse survival, and average total fluorescence value were measured. The results show that the PANC-1 pancreatic in-situ model was successfully established.
12. Establishment of NCI-H441 lung in-situ model using NKG mice



Figure 23. Establishment of a lung in-situ model using NKG mice. After transplanting the human lung cancer cell line NCI-H441 into NKG mice, the fluorescent effect and the average total fluorescence value were measured, and the lung tissue of the mice was observed by dissection. The results show that the NCI-H441 lung in-situ model was successfully established.
13. Establishment of MCF-7-luc breast cancer bone metastasis mouse model using NKG mice


Figure 24. Establishment of a breast cancer bone metastasis mouse model using NKG mice. Human breast cancer MCF-7-luc cells were inoculated into NKG (left) in the form of tibial injection, with a cell inoculation amount of 0.5×106 per mouse. At the same time, MCF-7-luc cells were inoculated into NKG in the form of iliac artery injection, with a cell inoculation amount of 1×106 per mouse (right). The results show that MCF-7-luc can effectively establish a bone metastasis tumor model in NKG mice.
14. H&E Staining
(1)H&E staining of various tissues of NKG mice

Figure 25. Pathological examination of NKG mice. No obvious abnormalities were observed in the lung, liver, heart, kidney, stomach, small intestine, colon, and cervix. However, the spleen lacked white pulp, and lymphocytes were reduced in the spleen and thymus.
(2)H&E staining results of spleen and thymus tissues

Figure 26. Pathological examination of spleen and thymus tissues in wild-type (WT) mice, NOD-Scid mice, and NKG mice. Results show that the spleen structure of wild-type mice is normal, with intact follicles and a normal red-to-white pulp ratio. In contrast, NOD-Scid and NKG mice exhibit a decreased number of lymphocytes and unclear red and white pulp boundaries in the spleen. Additionally, the thymus structure of wild-type mice is normal, whereas the thymuses of NOD-Scid and NKG mice are atrophied, with significantly reduced cortical and medullary lymphocytes.
15. Complete Blood Count (CBC) of 8-week-old NKG mice (n=20, data presented as Mean±SEM)

16. Blood biochemistry (n=8, data presented as Mean±SEM)

17. In vivo tumorigenic validation of human-derived tumor cell lines

*NOD-Scid mice (catalog number: C001070) are immunodeficient mice constructed by introducing the Prkdcscid mutation on a non-obese diabetic mouse (NOD) background strain with innate T and B lymphocyte immunodeficiency. BALB/c Nude mice (catalog number: C001217) are immunodeficient mice lacking mature T lymphocytes.
*The specific validation data in this table can be found on the official website.
관련 자료
1:1 상담
문의 사항이나 도움이 필요하신가요? <br> 아래 양식을 작성해 주시면 Cyagen 팀이 1~2 영업일 이내에 답변드리겠습니다.
관련 제품
모든 관련 제품리소스
출판물
Nature
2026-03-17
Proteasome-guided haem signalling axis contributes to T cell exhaustion
자세히 보기
Nature
2026-03-18
Proteasome-guided haem signalling axis contributes to T cell exhaustion
자세히 보기
Signal Transduction and Targeted Therapy
2024-06-23
Engineered extracellular vesicles for targeted reprogramming of cancer-associated fibroblasts to potentiate therapy of pancreatic cancer
자세히 보기
Nature Cancer
2025-03-17
A Gremlin 1-expressing splenic niche cell population restrains chronic myeloid leukemia by antagonizing the BMP pathway
자세히 보기
Nature Communications
2026-04-24
RPSA-OLFM4 axis governs neutrophil migration against bacterial infection and sepsis
자세히 보기
Nature Communications
2024-12-29
An antibody cocktail targeting two different CD73 epitopes enhances enzyme inhibition and tumor control
자세히 보기
Nature Communications
2024-10-19
Iron-loaded cancer-associated fibroblasts induce immunosuppression in prostate cancer
자세히 보기
Advanced Science
2024-02-21
RECQL4 Inhibits Radiation‐Induced Tumor Immune Awakening via Suppressing the cGAS‐STING Pathway in Hepatocellular Carcinoma
자세히 보기
Advanced Science
2025-01-21
A Novel 167‐Amino Acid Protein Encoded by CircPCSK6 Inhibits Intrahepatic Cholangiocarcinoma Progression via IKBα Ubiquitination
자세히 보기
Autophagy
2025-04-10
Inhibition of PINK1 senses ROS signaling to facilitate neuroblastoma cell pyroptosis
자세히 보기
Advanced Science
2025-01-20
A Novel 167-Amino Acid Protein Encoded by CircPCSK6 Inhibits Intrahepatic Cholangiocarcinoma Progression via IKBα Ubiquitination
자세히 보기
Science Advances
2025-12-31
Multidimensional mapping of stimulation-responsive regulatory elements and candidate causal variants in T cell activation
자세히 보기
Theranostics
2025-03-21
FOS-driven inflammatory CAFs promote colorectal cancer liver metastasis via the SFRP1-FGFR2-HIF1 axis
자세히 보기
MedComm
2024-10-21
Feedback loop LINC00511–YTHDF2–SOX2 regulatory network drives cholangiocarcinoma progression and stemness
자세히 보기
Cancer Immunology Research
2023-01-02
Enhancing the Antitumor Immunity of T Cells by Engineering the Lipid-Regulatory Site of the TCR/CD3 Complex
자세히 보기
ACS Materials Letters
2024-08-17
Bacterial Programmed Cell Death Induced by Nanotherapeutic Strategies
자세히 보기
Acta Biomaterialia
2023-08-31
PTT/ PDT-induced microbial apoptosis and wound healing depend on immune activation and macrophage phenotype transformation
자세히 보기
Pharmacological Research
2024-09
Developing patient-derived organoids to demonstrate JX24120 inhibits SAMe synthesis in endometrial cancer by targeting MAT2B
자세히 보기
Molecular Therapy
2025-02-04
Single-cell data-driven design of armed oncolytic virus to boost cooperative innate-adaptive immunity against cancer
자세히 보기
Materials Today Bio
2024-06
Enhancing glioma-specific drug delivery through self-assembly of macrophage membrane and targeted polymer assisted by low-frequency ultrasound irradiation
자세히 보기
Cell Death & Disease
2025-04-11
Interleukin-33 (IL-33) promotes DNA damage-resistance in lung cancer
자세히 보기
International Journal of Nanomedicine
2023-10-04
The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles in Alternating Magnetic Fields on Triple-Negative Breast Cancer
자세히 보기
International Journal of Biological Sciences
2025-01-19
SERINC2-mediated serine metabolism promotes cervical cancer progression and drives T cell exhaustion
자세히 보기
Neoplasia
2025-06-29
DHX34 deficiency triggers tumor-intrinsic immunity via a dsRNA-mediated type I interferon pathway activation in HCC
자세히 보기
Cell Reports
2025-05
Tumor microenvironment-associated oxidative stress impairs SIRT1 secretion to suppress anti-tumor immune response
자세히 보기
Journal of Translational Medicine
2026-05-13
KLRG1 silencing increases the efficacy of CAR NK cell therapy against colon cancer via SHP-2/ZAP-70/NF-κB signal pathway
자세히 보기
Journal of Translational Medicine
2024-02-17
Combined therapy of CAR-IL-15/IL-15Rα-T cells and GLIPR1 knockdown in cancer cells enhanced anti-tumor effect against gastric cancer
자세히 보기
Microbial Cell Factories
2023-05-16
Manufacture and evaluation of a HER2-positive breast cancer immunotoxin 4D5Fv-PE25
자세히 보기
Frontiers in Immunology
2025-01-16
A self-activated and protective module enhances the preclinical performance of allogeneic anti-CD70 CAR-T cells
자세히 보기
Cancers
2022-12-06
Role of Epidermal Growth Factor Receptor-Specific CAR-T Cells in the Suppression of Esophageal Squamous Cell Carcinoma
자세히 보기
Cancer Immunology, Immunotherapy
2025-12-18
Preclinical evaluation of CAR-T cell immunotherapy with a fully human EpCAM-specific scFv against pancreatic cancer
자세히 보기
ACS Pharmacology & Translational Science
2024-11-25
Gallium-68 Labeled Positron Emission Computed Tomography Tracer Targeting Glypican-3 with High Contrast for Hepatocellular Carcinoma Imaging
자세히 보기
British Journal of Haematology
2024-07-02
Development of novel humanized CD19/BAFFR bicistronic chimeric antigen receptor T cells with potent antitumor activity against B-cell lineage neoplasms
자세히 보기
Life
2025-07-18
Human Immune System Reconstitution in NOD/Shi-Prkdcscid Il2rgem1/Cyagen Mice to Study HIV Infection: Challenges and Pitfalls
자세히 보기
BMC Cancer
2022-09-08
MYBL2 regulates de novo purine synthesis by transcriptionally activating IMPDH1 in hepatocellular carcinoma cells
자세히 보기
Scientific Reports
2025-03-14
YTHDC1 negatively regulates UBE3A to influence RAD51 ubiquitination and inhibit apoptosis in colorectal cancer cells
자세히 보기
Regenerative Therapy
2024-03-25
Denosumab ameliorates osteoarthritis by protecting cartilage against degradation and modulating subchondral bone remodeling
자세히 보기
Heliyon
2024-01-29
The construction, validation and promotion of the nomogram prognosis prediction model of UCEC, and the experimental verification of the expression and knockdown of the key gene GPX4
자세히 보기
PLOS ONE
2024-09-24
TFAB002s, novel CD20-targeting T cell-dependent bispecific Fab-FabCH3 antibodies, exhibit potent antitumor efficacy against malignant B-cell lymphoma
자세히 보기
Discover Oncology
2024-04-01
Cyclovirobuxine D inhibits hepatocellular carcinoma growth by inducing ferroptosis of hepatocellular carcinoma cells
자세히 보기
Stem Cell Research
2024-12
Human induced pluripotent stem cell line (FDHSi005-A) derived from a patient with a deep intronic variant in the GNE gene
자세히 보기
Molecular Therapy
2025-02-05
Single-cell data-driven design of armed oncolytic virus to boost cooperative innate-adaptive immunity against cancer
자세히 보기
International Journal of Biological Sciences
2025-01-20
SERINC2-mediated serine metabolism promotes cervical cancer progression and drives T cell exhaustion
자세히 보기
Signal Transduction and Targeted Therapy
2024-06-24
Engineered extracellular vesicles for targeted reprogramming of cancer-associated fibroblasts to potentiate therapy of pancreatic cancer
자세히 보기
Discover Oncology
2024-04-02
Cyclovirobuxine D inhibits hepatocellular carcinoma growth by inducing ferroptosis of hepatocellular carcinoma cells
자세히 보기
BMC Cancer
2022-09-09
MYBL2 regulates de novo purine synthesis by transcriptionally activating IMPDH1 in hepatocellular carcinoma cells
자세히 보기
ACS Materials Letters
2024-08-18
Bacterial Programmed Cell Death Induced by Nanotherapeutic Strategies
자세히 보기
Heliyon
2024-01-30
The construction, validation and promotion of the nomogram prognosis prediction model of UCEC, and the experimental verification of the expression and knockdown of the key gene GPX4
자세히 보기
International Journal of Nanomedicine
2023-10-05
The Therapeutic Effects of MUC1-C shRNA@Fe3O4 Magnetic Nanoparticles in Alternating Magnetic Fields on Triple-Negative Breast Cancer
자세히 보기
预印本
2023-03-29
Extensive Dysregulation of SLK Splicing in Cancers Impacts Metastasis
자세히 보기
Cancer Immunology Research
2023-01-03
Enhancing the Antitumor Immunity of T Cells by Engineering the Lipid-Regulatory Site of the TCR/CD3 Complex
자세히 보기
Frontiers in Immunology
2025-01-17
A self-activated and protective module enhances the preclinical performance of allogeneic anti-CD70 CAR-T cells
자세히 보기
Stem Cell Research
2024-12-01
Human induced pluripotent stem cell line (FDHSi005-A) derived from a patient with a deep intronic variant in the GNE gene
자세히 보기
Nature Communications
2024-12-30
An antibody cocktail targeting two different CD73 epitopes enhances enzyme inhibition and tumor control
자세히 보기
The EMBO Journal
2025-01-28
Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis
자세히 보기
Preprint
2023-03-28
Extensive Dysregulation of SLK Splicing in Cancers Impacts Metastasis
자세히 보기
Advanced Science
2025-01-21
A Novel 167-Amino Acid Protein Encoded by CircPCSK6 Inhibits Intrahepatic Cholangiocarcinoma Progression via IKBα Ubiquitination
자세히 보기
PLoS ONE
2024-09-25
TFAB002s, novel CD20-targeting T cell-dependent bispecific Fab-FabCH3 antibodies, exhibit potent antitumor efficacy against malignant B-cell lymphoma
자세히 보기
British Journal of Haematology
2024-07-03
Development of novel humanized CD19/BAFFR bicistronic chimeric antigen receptor T cells with potent antitumor activity against B-cell lineage neoplasms
자세히 보기
Acta Biomaterialia
2023-09-01
PTT/ PDT-induced microbial apoptosis and wound healing depend on immune activation and macrophage phenotype transformation
자세히 보기
Nature Communications
2024-10-20
Iron-loaded cancer-associated fibroblasts induce immunosuppression in prostate cancer
자세히 보기
Materials Today Bio
2024-06-01
Enhancing glioma-specific drug delivery through self-assembly of macrophage membrane and targeted polymer assisted by low-frequency ultrasound irradiation
자세히 보기
ACS Pharmacology & Translational Science
2024-11-26
Gallium-68 Labeled Positron Emission Computed Tomography Tracer Targeting Glypican-3 with High Contrast for Hepatocellular Carcinoma Imaging
자세히 보기
Cancers
2022-12-07
Role of Epidermal Growth Factor Receptor-Specific CAR-T Cells in the Suppression of Esophageal Squamous Cell Carcinoma
자세히 보기
Pharmacological Research
2024-09-01
Developing patient-derived organoids to demonstrate JX24120 inhibits SAMe synthesis in endometrial cancer by targeting MAT2B
자세히 보기
Microbial Cell Factories
2023-05-17
Manufacture and evaluation of a HER2-positive breast cancer immunotoxin 4D5Fv-PE25
자세히 보기
Taylor & Francis
2024-09-30
Anti-HER2 biparatopic antibody KJ015 has near-native structure, functional balanced high affinity, and synergistic efficacy with anti-PD-1 treatment in vivo
자세히 보기
MedComm
2024-10-22
Feedback loop LINC00511–YTHDF2–SOX2 regulatory network drives cholangiocarcinoma progression and stemness
자세히 보기
Taylor & Francis
2024-10-01
Anti-HER2 biparatopic antibody KJ015 has near-native structure, functional balanced high affinity, and synergistic efficacy with anti-PD-1 treatment in vivo
자세히 보기
Journal of Translational Medicine
2024-02-18
Combined therapy of CAR-IL-15/IL-15Rα-T cells and GLIPR1 knockdown in cancer cells enhanced anti-tumor effect against gastric cancer
자세히 보기
The EMBO Journal
2025-01-27
Micropeptide hSPAR regulates glutamine levels and suppresses mammary tumor growth via a TRIM21-P27KIP1-mTOR axis
자세히 보기
Items: 1 to 5 of 71
1
2
3
4
5
6
...
14
15
문의하기
맞춤형 동물 모델 관련 상담을 위해 Cyagen 전문가와 연락해 보세요. 아래 양식을 작성하여 상담을 시작하거나 견적을 요청하시기 바랍니다.
Cyagen은 고객님의 개인정보를 소중히 여깁니다. 최신 제품, 서비스 및 인사이트를 안내드리고자 합니다. 고객님의 수신 설정은 다음과 같습니다:
해당 커뮤니케이션은 언제든지 수신 거부하실 수 있습니다. 수신 거부 방법 및 데이터 보호에 대한 자세한 내용은 개인정보처리방침을 참고해 주시기 바랍니다.
아래 버튼을 클릭함으로써, 요청하신 콘텐츠 제공을 위해 본 양식을 통해 제출된 개인정보를 Cyagen이 저장 및 처리하는 데 동의하게 됩니다.
